|
|
|
|
AUTHOR |
|
Hye-Min Lim, Jung-Il Cho, Sichul Lee, Man-Ho Cho, Seong Hee Bhoo, Gynheung An, Tae-Ryong Hahn, Jong-Seong Jeon (2007) |
|
|
|
|
TITLE |
|
Identification of a 20-bp regulatory element of the Arabidopsis pyrophosphate:fructose-6-phosphate 1-phosphotransferase ¥á2 gene that is essential for expression |
|
|
|
JOURNAL |
|
Plant Cell Reports 26: 683-692 |
|
|
|
File |
|
|
|
|
|
The Abstract Of The Paper |
|
|
Arabidopsis harbors two and two genes of pyrophosphate:fructose-6-phosphate 1-phosphotransferase (PFP). The spatial expression patterns of the two AtPFP genes were analyzed using transgenic plants containing a promoter:: ©¬-glucuronidase (GUS) fusion construct. Whereas the AtPFP1 promoter was found to be ubiquitously active in all tissues, the AtPFP2 promoter is preferentially expressed in specific heterotrophic regions of the Arabidopsis plant such as the trichomes of leaves, cotyledon veins, roots, and the stamen and gynoecium of the flowers. Serial deletion analysis of the AtPFP2 promoter identified a key regulatory element from nucleotides -194 to -175, CGAAAAAGGTAAGGGTATAT, which we have termed PFP2 and which is essential for AtPFP2 gene expression. Using a GUS fusion construct driven by this 20-bp sequence in conjunction with a -46 CaMV35S minimal promoter, we also demonstrate that PFP2 is sufficient for normal AtPFP2 expression. Hence, this element can not only be used to isolate essential DNA-binding protein(s) that control the expression of the carbon metabolic enzyme AtPFP2, but has also the potential to be utilized in the production of useful compounds in a specific organ such as the leaf trichomes.
|
|
|
Copyright 2004 (c) Plant Functional Genomics Lab. Department of Biological Sciences, Kyung Hee University
1, Sochen-dong, Giheung-gu, Yongin-si, Gyeonggi-do, Korea. Zip code : 446-701 Tel : 82-31-201-3671
All rights reserved. The last homepage modified 10/22/2004 09:41:15.
|
|
- Counting status :
visited today,
visited yesterday,
visited in sum.
|
|
|